EST 1609526 is a singleton


Sequence

>1609526 (1 EST) Length=305 CTCCGGTGCGTTAAAGCATGGACTTGTCTTCACCGCGTANCCCCGACATTTCTTTGCACCCCGCTATCANACAGTAGCCG CAAATTTGTGAGTCNCAGGANAAANAACAGTGCCCATGCGCTGGAAATTGGGTGGGACNAGGTGCCGTCCGCANAACACT GCCCCCCCCCTGCATTCACATATGGAGGAGGAGCTTCTGTAACGCTAACAACAACNAAAAAAAAGAGGAGAAAAAAAAGT NCCNNCNAAAAAAAATTTTTTATTGGGAGGGAAATTCTCCTTTTAAAAAAGGTAATTAGGGGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609526: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095262991675AA882564TENS0135T. cruzi epimastigote normalized cDNA Library


Date: 12:38:34 on Tue 21 Nov 117.