EST 1609557 is a singleton


Sequence

>1609557 (1 EST) Length=303 TCAANAGGNAACAGAGAAGGCCATGTCTCTTAAAGTTTCAAGTTCGGCAAAGAGTGTAAAAAAAAAAACCCTCCTTTGTG CAAATGCATTTAGCGCATGTTTTTCAGCTTTTTTTTTTTTTGTCGTTAAATCATTGCATGCGCTTTCTCCACTATTGTAT TTATATATACATTTATATATACATTTACATTTATATTTATATTTATTTANATATATGTGTTAATTCCACGGGAANATTGG CATTTACCACAAAACGGAACATCTTTACTTGAATACCCTTCTAACAGCAGGAGCACACTCTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1609557: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095572991706AA882595TENS0166T. cruzi epimastigote normalized cDNA Library


Date: 13:38:49 on Thu 23 Nov 117.