EST 1609565 is a singleton


Sequence

>1609565 (1 EST) Length=295 TAATTTTTCCGCCCNAAAAAAAATATTTTTTATAATTTGCTAGCGAGTAACTTTTATTGTCTAGGGGGTTGTGAGGAGAA TGATCGGGAGGANAGCTGGCGAACGGTAATTTAATATATATGTATATATTCTGCTAAAAATAATAAACACTTCTTTACNA CGCCTTTCTGTCTTATGAATTTTGTGAAGGCCACNACTTTAATGACTTTAGGGATCCAGCAGCGGCCGGATAATTTTTTG TTTTTACCATCGCACCTGCCCCCTTTTTAGGTTCCCGCCACNCGGCGGGGTCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1609565: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095652991714AA882603TENS0174T. cruzi epimastigote normalized cDNA Library


Date: 6:55:24 on Sat 25 Nov 117.