EST 1609586 is a singleton


Sequence

>1609586 (1 EST) Length=289 TNAGGNTGACCCTGCTTGACCTGTGCCATNACGAGAGCCGCCTCACCCTCGTGTTTGAGTACATGGAGCTGGACTTGAAA AAGTACATGGATCAGGAANAGGGCAATTTGGATGCGGCCACCATTCAAGACTTCATGCGGGACCTTTTGAATGGAGTGCG ATTTTGTCACGATCGGAATGTTTTGCACCGGGATCTTAAGCCACCGAATTTACTCATTTCCCGTGAGAANAGCCTTAAAC TGGCAGACTTTGGTCTGGGACGTGCGTTTGGCATTCCCGTGAANAAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1609586: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095862991735AA882624TENS0195T. cruzi epimastigote normalized cDNA Library


Date: 2:59:7 on Mon 20 Nov 117.