EST 1609623 is a singleton


Sequence

>1609623 (1 EST) Length=281 TANTCGGCACGAGGATCAGCTCCACACCACTGAACGACCACACTCACGATGACNACGTGCCGTCTGCTGTGCGCCCTGCT GGTGCTCGTCCTGTGCTGCTGCCCGTCCGTGTGCGCGGCAGGGAGTGAAGTTGCAACTGGTAAATCTGTAAAANATTCCG TTCCAACAAATTCTATGCCTGTCGACCCAAAGCAGGTAACGGATCCGCTAAGTACAACTCCTTCTCCACCAGAGAATAAA CGATGAAGTGGGAGGGACGGAACAGTCACATACAACGGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1609623: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096232991772AA882661TENS0234T. cruzi epimastigote normalized cDNA Library


Date: 12:49:25 on Fri 17 Nov 117.