EST 1609630 is a singleton


Sequence

>1609630 (1 EST) Length=344 CTGCTGNTCCCACATGAGGAAGATGCAATGTGTGCTGCTGGGGNGACNGAGAGCCATACTGCTGATACTNTTCCTGTGAT GCTGACGAACTGGCAATGGGTACTGTGTAAGAAAGAAGCTGCTGGTTTACAGATGTCATTGGACTGAAGAATGCAGAGAG GAATGGACAGCTTAGACCTACTAGAATATATATCCATCTGTGTCATGTGAGTACAGATATGTCTGTCCAGTGTGTGAAAA ACAGAGACTGCATGCATCTGCAGAGTGAGAGAATGCGCTATCAGTGCCATGATGATCTCGACATCGATCTNGACATCAGG TGCATCGATGCTGCAGCGTGGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609630: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096302991779AA882668TENS0241T. cruzi epimastigote normalized cDNA Library


Date: 8:22:53 on Wed 22 Nov 117.