EST 1609633 is a singleton


Sequence

>1609633 (1 EST) Length=233 ATTTTATTATGTGGAGAGGAGGGATAATAATACTAACAATATTAATAATAATAGTAATAACACTGCGCAAAAATGTTGTT CAGATTGTAAGTAACGTTGCGGACAAGGTGGATCTTTCATTGAGGATGAAATGACTGTTGGTGAGTGCGTGTGTTAATCG ACAATGATGACGACGATGAAAGACGATCGCTTACTCAGCANCTGAGACGACAGCACTGATGATAGAGACTAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1609633: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096332991782AA882671TENS0244T. cruzi epimastigote normalized cDNA Library


Date: 12:45:9 on Sat 18 Nov 117.