EST 1609638 is a singleton


Sequence

>1609638 (1 EST) Length=302 GAGAAAACGGGACCACCACCTCCCGCATACGAGCAAACGAACAGTCCAGCACAGAGTTCTGACGGTTCGGCATCCGAAGA AGGAAGCACTTCATAAATGTCCCTTGATGCGACAGGCAGGCGTGGCAGTGCCGGGGGATTGAACACCCACACCTCGGCAC AAACATCCTACGACAGAAAGAAAGTCGTGATCACAAATGGAGATTGAATAGTCACGCTGCTTAGCAAGGCTCGAACCTAG CATGAAGACACTAACCACACAGAACCTGCCTGCATCAGAGAGCAATCACTGGAACGNCGGNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609638: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096382991787AA882676TENS0249T. cruzi epimastigote normalized cDNA Library


Date: 2:50:52 on Tue 21 Nov 117.