EST 1609646 is a singleton


Sequence

>1609646 (1 EST) Length=282 AAGGAGCTCATTGAAAAGGTATTTGGGCGGAATGATGTTGCAATTGTGATGGGACTAGGAATGGTGATTCACCTGTGGTA CACAAATAATGTCATTGCGTGGANAGCCATCCGGAGGGAGCAAAAAGGTAGCTCGGGTTTCTGCATCAATGAACTGCACC CAGTCATTCGAAATGTGCTTGANAATAGTGTTGAAAAGCATTCTCGTGTGCGTCTTCTTCCGGCAACCATGCCCGCGATC AAGGATTCGGTGTTGCACGTGAAATTGANTGTATTGGGCGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609646: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096462991795AA882684TENS0258T. cruzi epimastigote normalized cDNA Library


Date: 12:34:45 on Sun 19 Nov 117.