EST 1609647 is a singleton


Sequence

>1609647 (1 EST) Length=261 AGGCTAGGGCCGTGCAGGAANACACGTTTATTATNAGTTGAAAAAAAAGTTGGTTGGTGTGAGTGTGTGTGGGGCTGGCA ATGGGCAACAACGACTTTTTGCGGTCCACGGCGCAGCGTCTGCCACCGGACCTCTCCGACAGCCAAAAGGACNAAATTGC CGAGGCGTTTCNCATCATGGACGTGGACGGAACAGAAACNATCNCNCCCAACGATCTCAAGGTGGTCCTTCNCGCCCTCG GGTTTGANCCGCAAAAGGACN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1609647: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096472991796AA882685TENS0259T. cruzi epimastigote normalized cDNA Library


Date: 14:17:24 on Mon 20 Nov 117.