EST 1609648 is a singleton


Sequence

>1609648 (1 EST) Length=294 NCAANAGGTTTTTTTTTNNTCTTTTCGCATCNAGCAAAAATAANAAATCCATTTAAAAAAAAAGAAAAAAAAAACAAGCG GGACAACNTAAAATAATAAAAATAAAAAACAACACCATAAAAATAAATCGTTGCGGCCAACTCAAAAAAAAAAAATNTTT CTACCANAAGCTCACAAGACAACAAAATGANAAAAGGCAACTTGACCAAAATCCCATTCTCTTATGAACTCACCTGATGA CCTTCTGCACTGGTGCCTTGTTGCTCCCCCNAAAGCGGCGCCTGTTCTCCCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609648: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096482991797AA882686TENS0260T. cruzi epimastigote normalized cDNA Library


Date: 21:52:30 on Fri 17 Nov 117.