EST 1609654 is a singleton


Sequence

>1609654 (1 EST) Length=296 CAGGCACGAGGTTTCGACATCCACATCCTGACTTTCTTCGTACGCTTGCCTCGCTCAACGATGACTCCACAGATATCGAT CTCTATCCACAANAACTGCCTCGTATTCCTGCGTCCCGACTTGGTTTTGTCCGCGGCCTGAACAAAATGATTCTCTCCAA GGATGAACCAAATAAATTCTTCTTCACATGCACCACGAGAGATTTCAAACCATTTGATGGCATCAGCGGTTTTCCAGATG TTGAAACAGATCGGTTCACGAATAGTCTAGATGAGTACGCCCCATACGATGCAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609654: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096542991803AA882692TENS0266T. cruzi epimastigote normalized cDNA Library


Date: 8:33:37 on Fri 24 Nov 117.