EST 1609661 is a singleton


Sequence

>1609661 (1 EST) Length=257 TTCTGAGGNTGTTCCGTTCNAGGATCTCTCCCTNCCCTGCAAAACTCNAAAAAAAAGGGANAGGAAAGAGAATAGAGGAA TAGAGTAATAATAATAATAATAATAATAATAATAATTGAAGATAAGTACACAGCCACAGAAACAGAAGAGAAAGAAAACG GCTGTACAGAANAATTATTATTTATTTATTTTTTATTATGAGGCACATAAATATATATTTATATATATGTGCATGTGTAG TGTGGGGTTTACTGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1609661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096612991810AA882699TENS0273T. cruzi epimastigote normalized cDNA Library


Date: 8:54:20 on Mon 20 Nov 117.