EST 1609710 is a singleton


Sequence

>1609710 (1 EST) Length=308 TTCAAAACGCGGCNCGANGGTCCGGACCANAGGNACCGGTCACGCTGTTGGTGCGCCGAANTGTCCCGAACATGCCACCA CCCAAGCCAAAACACCAACGGCAAATTGTTGAAACACTCTCCATGTTGTTGTCTCATCAACGTGCTGTATGCGCCCGGGA ANAGGAGCAGCGGTATGCAAATGANAACCGTGCATGGGTAGAAAACTGGCTGCTGCTTGTAAAANACGCTAANATTCAAT ATCGTGCCCGTTGTTGGTGTCTTCTTCTTCATGCCATCGAGGATTTCAATGGTGCCTTGGAGTATCNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609710: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097102991859AA882748TENS0323T. cruzi epimastigote normalized cDNA Library


Date: 21:51:8 on Sat 18 Nov 117.