EST 1609714 is a singleton


Sequence

>1609714 (1 EST) Length=181 CATTTTTNTTACCGACAAGTCTGGAAATATCCTGCGGAGGGTTTTTCTCTCGGACACAAGAGACGGATACACGGCAAGCA GGCCTTTACATCGCCGAATGTGCTCTCATCTCAGTATGCATGCAGATGGCCAAGGAAGGCACTGCTGGGGCTTCGGTAGT ATTACACCCATGCTGGCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609714: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097142991863AA882752TENS0327T. cruzi epimastigote normalized cDNA Library


Date: 9:45:42 on Thu 23 Nov 117.