EST 1609724 is a singleton


Sequence

>1609724 (1 EST) Length=293 TGCAANACGGTGTTTTAGGTTTCTTTCTTTTGACATTGTTTACGCCTCTTTGCCGCATTTTGTGTATGCACGTGTCTCTT GCAGTTCCTGCGTGTACGCCCACGGTTTTTAGTTTTAAAAAAAACAAAATGTGTGGGGTAATGCAGTGGACGCTGGGAGC AAGGAAGCATCGTGTGGAAAAAGCGGATCCGAAAACATGATTTATTTCCACCACTCTTTATTTTTTTTCATTATTTATTT TACTCCGAAACATGTGGGAANAATGTGCGTCNCGATGAGGCTGAGCAGATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1609724: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097242991873AA882762TENS0337T. cruzi epimastigote normalized cDNA Library


Date: 0:55:49 on Wed 22 Nov 117.