EST 1609734 is a singleton


Sequence

>1609734 (1 EST) Length=280 AACGAGGGTGACTGNCCCCCACAGTGANGGTTCACCTCTGCATTGGTGCAGGCGGCGCTGCGTGACNCGAACGGTGAGCC GCTTCTGCAGATCCCCATGGAGCGTGTCTCTGANGCGACGGTGGCATCCGTGACTGGCCTCATCGCGCGCAGCAGCACCG TCGTGGCANANAACGTCTCCGGGGCGTTTGTGATGGATGCCGGGACGCGTCTTTGTCTCGGTGACGGCTTCNTGGTTGGT GTCTTCACCACTGTNATGGGCCCTGTGTCTTGCTGCGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609734: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097342991883AA882772TENS0347T. cruzi epimastigote normalized cDNA Library


Date: 14:29:33 on Sun 19 Nov 117.