EST 1609744 is a singleton


Sequence

>1609744 (1 EST) Length=289 GCAAGAGGCAACAGTTACNGGNCAATTGCGGGGACATTGTGTTTGTGATGGACTGTCGCGAGTTGATTGAGGACTCCCGC GCGCGTCTAATCGATACGGTGTGCGCTGCCTACAGATACAACCCTGAGCTTTCGGTTGATTTGGAGGCAAAGCAGCGTCT CGAGAGCGCGGCACCGCTGCGTTTGAATTTCAACCTTACCTCCATTTATGATCATTCGGTTTTTCAGGCCTTCTCATTGG TGGTGCAAAAACTCATCAAACCACAGTCCCCATACATCACAGAGCTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609744: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097442991893AA882782TENS0357T. cruzi epimastigote normalized cDNA Library


Date: 4:25:34 on Thu 23 Nov 117.