EST 1609756 is a singleton


Sequence

>1609756 (1 EST) Length=296 TNGCACGAGGCACNATTCCGCGGAGCAGTTGTGGTCAAGGAAATTGAGGGCGAAAGTGAACAGGACTGACGGTGATAGAA GTAGGGATTGTTTTCCTGATGATGGTAACAGGTTGAGTANTCACGGGGCATCAGTGTTGCATCAAACAGCTGCACTGGAT GTTTTCANANACAGTTTCATCTCTGCGGGGTGGCAAGAAAATCGCCCTGACAANTTCTTTGACAACGTGTGCCGCGAAAA AATTCGAGAGACGCCTTTGGAAGAAAAAAGTTGTGCCACGTCAANATTTTGAGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609756: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097562991905AA882794TENS0369T. cruzi epimastigote normalized cDNA Library


Date: 6:58:49 on Mon 20 Nov 117.