EST 1609758 is a singleton


Sequence

>1609758 (1 EST) Length=227 AGCAACTGCAANCACGGATGGAGCTCGCGAATGCCATCGCTGACGCCTGTCTGCCAGTGGCGGATTCCGCGAGTGATGCG TCTCAATTCTTGCGCGCGTTCTTCGCTGCTCTCCGTGCCGCAAATGGTTCGTCATCGTCTCATGTCGTATGGACTCAGCG TGTAGGCAGGATGGCACACATCTAGTCGCTACGACACTGCGCATTGTGTGCGATTATCTAGCTCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609758: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097582991907AA882796TENS0371T. cruzi epimastigote normalized cDNA Library


Date: 1:58:41 on Sat 18 Nov 117.