EST 1609770 is a singleton


Sequence

>1609770 (1 EST) Length=293 GNCANGAGGCTGTTTATACCTCNANAATTGGTGNAACAGCTACCTTGTTTCGAGAGACGGCAGATTATAGTGTGTTTCGT TGCCCCAAGTGTAATANCATGAACACAGTGTCGTTATTGGCTCANATTTACGCTCCTCTGGACGTCTACAACCGTTTGCT GTACGTACTCACTTGCTCCACGTGCAGTACTGAGCANAGCACTTTTTGTTTTGCTCTTCGATCTCANAATTTTAATCCTT CTTACAAAAATGTATCGCANACAAACGACAAGGGGGGCTGCGAGGACAAACGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097702991919AA882808TENS0383T. cruzi epimastigote normalized cDNA Library


Date: 19:18:6 on Wed 22 Nov 117.