EST 1609780 is a singleton


Sequence

>1609780 (1 EST) Length=278 TAAANAGGTTTTTTTTTGGGCCNTTTCCTCCTCATCGCTCTGCAGCTCCGGCGATAAACCACGCTTGACGCGCCTTCCCG CCCGCATTGACGGAAAANTGCTGTGCATCTGCTGCTGCTGTCGCAACCCTTGGGANAAAACGCATGCACCTTGCGGGAGG CGCTGGGCTGCAGGGACGGCGCGGCTCTTCAACGTCTCAGCCATCCGTACCTCATTCTCCGTCGTCTCCACAAATTCCTC TGCCGCGGTGATNACCTCCGCCGCATCGGATAGGGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609780: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097802991929AA882818TENS0393T. cruzi epimastigote normalized cDNA Library


Date: 8:44:52 on Mon 20 Nov 117.