EST 1609781 is a singleton


Sequence

>1609781 (1 EST) Length=292 CACNAGGGCCGATTTCATGGAGAAAAATGTATTTTTACGCCAATCCAACACGACAGTGAAGCTCATGCTCTGGGACACGG CCGGGCAGGAGGTGTTCAATTCCCTCACACAGGCGTATTATCGTGGGGCTGGCGCGGCGATAGTGGCATTAGTACCGTCG ACAAGGATAGCTTTATGAATGTTGAGAACTGGAAGAAAAACGTTGAGAATGTGTGCGGATCCATTTTAATGGTTCTTTGC CAGACNAAGTTTGACCTTGCACACNAGGCGGCCGTCACGAATGAGGAGGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1609781: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097812991930AA882819TENS0394T. cruzi epimastigote normalized cDNA Library


Date: 11:59:51 on Fri 24 Nov 117.