EST 1609808 is a singleton


Sequence

>1609808 (1 EST) Length=290 TGCAANAGGCAACTCTTCGGCCGGAGCATACAAACCACCCACGGACAGGCCATCGGCTGGTGCGTACAAGCCACCCACGG AAAAGCCATCGGCTGGAGCATACNTGCCATCAACTAACAAAACTGAGGGAACACCGATTTCGCCCACGGACAACTCTTCG GCTGGAGCATACAAGCCACCCACAGACAGGCCATCGGCTGGTGTGTACAAGCCACCCACGGACAGGCCATCGACTGGTGC GTACAAGCCACCCACANATAGGCCATCGGCTGGTGCGTACAAGCCACCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609808: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098082991957AA882846TENS0421T. cruzi epimastigote normalized cDNA Library


Date: 18:51:55 on Thu 23 Nov 117.