EST 1609812 is a singleton


Sequence

>1609812 (1 EST) Length=293 CGANACGAGGCAACCAGTCCTTCTGGTTTCATGCAACAGCGTGCAANATCACCAGGTGAAAAGGTTTCACCTCGCTTGGC CGCCTTTCCCCAGCCAACCTTTATGCCTAACGCAGCGGCGGACGAGGATGCCGACGTCAACGAATTAAGGGTGCCTATTC AAGAANTGTACAGGGGACTCAATGAAAAGCTTAAAAAACAACAAGACGAGAGGATACAGTGGCGAGAATGTACTAGGGAG GTTTTGCGTGAATTCTGGGGAGCACAGAAGCCAGGTGCTTCTTTATTGTCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609812: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098122991961AA882850TENS0425T. cruzi epimastigote normalized cDNA Library


Date: 14:26:7 on Tue 21 Nov 117.