EST 1609820 is a singleton


Sequence

>1609820 (1 EST) Length=287 CNTATCAGGCTCTCCTTTGCAAAAATTGGCGATGNNCCCAGAAATGACAACAACCACAGCAACAAANTGGTGGACAGGGT GCCACGGCCCGTGGATCGTTGGGATCGGGCACNTCGGCCGCGCAGCGATACTGACNACGGGTGGCGGCAGGGAGAGAGCG CAAGGCTGANTCNCCGACGAAAACACTACGAAAATGATCGTCNTTCAAGGCGACAGGATANAAGGCGATCCCCGCGACGG CATCCCTCGAGCTCTGCATCGCGTTCATCTTCACCTTCGCGGAGGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609820: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098202991969AA882858TENS0433T. cruzi epimastigote normalized cDNA Library


Date: 13:42:43 on Fri 24 Nov 117.