EST 1609826 is a singleton


Sequence

>1609826 (1 EST) Length=293 AGGTTTAGANGGTTCTCCAAGGAAACACGGGTTATAACGCGTAAGCTCAGTTGGCAATATGTACTCTTATGGCAATGGAN ACCTTGACAGTCAANTCCAACGCCTCTTTGCCAACGTAGACTATCAGTTGGAGCAGTGGAACAAGAAGTACGGGTCGAAA AACTTCTGCGTGGCGCCGGACNAAGCCCACTCCGTTGAAANAAATACCCATGCCTCTGATGCAACCCCCCAATTGAATGC GGACCGCAAATGTCTTGGGTGCATGCAACGTACAGCGGCACCGAGTTCTACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609826: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098262991975AA882864TENS0439T. cruzi epimastigote normalized cDNA Library


Date: 14:41:45 on Fri 17 Nov 117.