EST 1609832 is a singleton


Sequence

>1609832 (1 EST) Length=302 GGCACNAGGNGTCGTTGTTGTTATTGGTTTTGTGGATGTTATTCCCATTTCTTGGTGCTCTTTGCCCGTCATCATTGAAA AANAGTAGTGGTTATACAAGCGCCAATACTCTTTCACACGCATTTCACGGCACACACTACATACACGCNTGCCGATACGC GGGACCCCGCTATTTCAAATAATGAGGATTTTTTTCACTCTCTTGTTTTGATCTTTCCAACGCGACAAACACTTTTATGT GATTAGTTATTGAGACGTGTCAAGAGCAACAGCGGCAACAACGTNACTAAGGAAATAAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609832: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098322991981AA882870TENS0445T. cruzi epimastigote normalized cDNA Library


Date: 1:46:47 on Sat 18 Nov 117.