EST 1609842 is a singleton


Sequence

>1609842 (1 EST) Length=279 TANAAAGGGTTTCTGTNGNCCATTGCCTCTAAANAAGTGTGAATAGGCACTGCTGCCTGCGTGAATACACACTCGTTTGT GGATGAGCCCAGTGCGCACAGCCGTCGTGGCGGGAGGAGGAGCGCTGCGGCTGCTGCGCTCCATCCATCTGCCCTGTGCG GCCTTTCATCGTTGCGGTTTTTCCTCGTGGGGATGTCGTCGTGGCGTCTTGTCGGTGCCGGTGGAGGATTTGACNCCNAA ATCCATTGCGTTGTTTCACTCGTACGGCCCCCCGACATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609842: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098422991991AA882880TENS0455T. cruzi epimastigote normalized cDNA Library


Date: 9:23:46 on Sun 19 Nov 117.