EST 1609850 is a singleton


Sequence

>1609850 (1 EST) Length=292 TCAANAGGCTTGAGTTGNGACAGTTTGATGAAATAGTGCTGAGCGCATCCTGTGCATTTTTGGCGAGTAAAGTTGAGCAT TACAAAGTGCGCCTAAATCGGGTAATTGCGCTTGTTTTTGAAATCAGTGGGGAGGGCGATGANATGGAGGGGTGGCGAAG GATGTTGTTGGAGATGGAGCTGCTTGTTTGCCATACGCTGGGCTTTAATTTTCANATAATTCACCCAATGAAGCGTATCG TCNAGTTGGTGCCGGAANATCACACGCAAGTGTTGGAATGTGCACATCGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609850: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098502991999AA882888TENS0463T. cruzi epimastigote normalized cDNA Library


Date: 8:49:31 on Fri 24 Nov 117.