EST 1609867 is a singleton


Sequence

>1609867 (1 EST) Length=275 NNTGCATATCTTCTTCGGGTATTGGTANAGTGCTTTCCATGTCGCTTTGATAACGTTTCCGCTATAAATCCACTGCTGCA GGCACTTTGGGGAATTGCTGGAAGCCAANACAAAATTCCCGCGGCGGTAGACAATGCGGTGTCTGCGACATGCACAATGG TGCGCTTTCTCTCACCGACTACCATTCCCCTTTCATCTGTTGTCCCTGCGCTGCTGGAACGGATACCGATGCGTGTGGAT CGAACCGAAAACGCCAATGCCATTCGAACAATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609867: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098672992016AA882905TENS0482T. cruzi epimastigote normalized cDNA Library


Date: 22:50:48 on Wed 22 Nov 117.