EST 1609872 is a singleton


Sequence

>1609872 (1 EST) Length=268 AGGGTCAANTGCCACATGAACAAACAGTTGCTGCANACACTACCGCTAGCAAAGGGTAAANACATTCACAGCCGCGTGGC AAAGTTGGCTCTTTACAAGGAATGCATTGCGCTTGCAAANAATGTCGGCGACCCGCTCGTGCGTCAGCATACTCTGGTGG AGGTGCGAGAAAAGTGGATGCAAAACCGCGGCTGTGGTGGACATTCACTTCAGCTGCAGATAGCAAGCGCACTTGACCGT ATTTCATACGGCCGCATGTGTGTATCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609872: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098722992021AA882910TENS0487T. cruzi epimastigote normalized cDNA Library


Date: 14:36:46 on Sun 19 Nov 117.