EST 1609891 is a singleton


Sequence

>1609891 (1 EST) Length=283 GCCGATTTNANCTTGGCAGAGGGCTCAGGCCACCNAGGAAGCGCACGTCGCCTGCCGACNACACACCGATAAGATCAACA CCTGTTGAATTTCGCCGTCCAGCATGCGGCTTTCGGTGCCACAGCAGTGAAGGATTGACCCACCGCCGCACGGCATGCCA CAACCACCGACTGGACATTGTGAAAACCAGCCAACGTGAGCTGCGCGAANAGACAATTCTGCATCTACTCCGCTGCCCGG CTCTGCAGTTGCCCGGACAAAAAACGTGGAATGGACACTGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1609891: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098912992040AA882929TENS0506T. cruzi epimastigote normalized cDNA Library


Date: 4:26:35 on Fri 24 Nov 117.