EST 1609906 is a singleton


Sequence

>1609906 (1 EST) Length=259 ATATTGAAGCCTAGGAGCTAGAGCCTACCAATTGGTCTGGCTTTGCGGTGATTTATGTCGGGTGATACATACTTCCGCCG TGCCATTGATTGGATGTACGGCGACACGGCTTACCTGCAGAANATGCCAAGCCCGGAGATTGGCGAAAAACACATTAATG AACTTCTTGGTCGCCATCCTTTTCACCCATTTGATCCGGAAATGAAACCAGACCATCCCTGCTACAATGCAAACGCCATT TTTTACAACTGCATGACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609906: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099062992055AA882944TENS0521T. cruzi epimastigote normalized cDNA Library


Date: 11:20:51 on Sun 19 Nov 117.