EST 1609925 is a singleton


Sequence

>1609925 (1 EST) Length=272 CCTTNTGNAGGTTTGCTNTCGTTTAGAGTNTTTTTNAGGGCCNTGTGGTCAANGCCGCCGTTGCNTTGGCGGCCCCACCC TCTCGTGTTTTCTTTCCACCCCGTGAAGCATCCTTGCCGTTGCGAAACACNACACTGGCACCCGGCAGCGTCTTGAGGCG TGCTGANACAATATCGANAGTCAACCCAAACCACCTTGGTCCACGCACCACCATGCCGCCCTTGGCGTCACGCTTCTCCC CCACAATTTCCCCCAACCTCTCCGAAAAGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609925: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099252992074AA882963TENS0540T. cruzi epimastigote normalized cDNA Library


Date: 20:47:1 on Tue 21 Nov 117.