EST 1609932 is a singleton


Sequence

>1609932 (1 EST) Length=256 AATGGGATAACAAACCAGTCTTTTTTCCGAGGGAGAAGTACGCAAAAATAGCGCATGGGCGAAACATTTTTTTGGCAACG TGTCTTGGTGGGGCTGCCTTGGTGTGGGGAGCTAGCCTGATTCCGCAGTGGCTGATTTACCGCTCCTTGAGGCGAATGTN CCAAACATATTGTCGTGGTCNAGTGCTAGATCTGACGCCAAAAATAGCGGATGCCAGCGATGTCCGACTTTATGAGATGT CTAAAGCAATTCGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609932: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099322992081AA882970TENS0547T. cruzi epimastigote normalized cDNA Library


Date: 20:1:59 on Sat 18 Nov 117.