EST 1609933 is a singleton


Sequence

>1609933 (1 EST) Length=287 TCCGAGGCTAGNTCTTCGTTACAAGGGCAGTAATCAGGCCNCACTTGTCCNGGGGACCCTCAATGCCACACCACTCACTG GCCTACATGGCGCCAAAATCACGCCTTCAACAACCCGAAAAGACGCACGGCGGGCTCCCGTCCCTCTTCCTCGCAACGCA CTGCACCTTGGCAGCACNTGAGGACGGCCGGCCGGCCGCACNAGGGTTGANAATAATAAGGGTTCTGTAGAAAATGAGGA AAAACACGCTTACTTTCATGGAAATGTACCAGGGTAGGTATTCTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609933: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099332992082AA882971TENS0548T. cruzi epimastigote normalized cDNA Library


Date: 3:51:30 on Sat 18 Nov 117.