EST 1609937 is a singleton


Sequence

>1609937 (1 EST) Length=280 GTTNGCCNTCGTTTAAGGGGGAGAGAAAGANCNTAAACAGTTANATAAAAAGAATCGTGGGAGAAAGCAGAAAAAGAGGA AAAATGTACATGAAAACAGAGAAATAAAAAGTTCATCTATTTGATCTTTCACACGTTTCCCCCCCCTCGCGTACCAGCAA ATGCCATCAATTTCATCATATGTGTGTCTGGTGCCGACTGGTGAAATTATACATCGCGTCAACTGCGTTCCCACCCCAAG CAATCGCCGTTACTCCCAAATCAAGAAAATTAACTAAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609937: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099372992086AA882975TENS0552T. cruzi epimastigote normalized cDNA Library


Date: 3:7:46 on Tue 21 Nov 117.