EST 1609946 is a singleton


Sequence

>1609946 (1 EST) Length=293 ANGCTACAACAGAGGNCCCCAAGCAGGATGGGAAAGGAGTGTCTGCCACAGATTTTGCCATGGTGGCAGCAAATGAANAG TTTACCACGACNATTGGGGAAATGCGGGGAGTGATCAANAGCGTTGAGGCGAGTGAGGCGCGCCTGACCGCCGAGGGCGG CGAGACGGCGCTGAACCATATTGCTGCCATGAAGGAGTGCGTGGAGGCGTACGCGGCGTTGCCCCTTGAGAGACAGAAGC TAAATGAACTCGCGGCAGATGCCACACGCAAATACAAGTCTCCCGTGTTTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609946: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099462992095AA882984TENS0561T. cruzi epimastigote normalized cDNA Library


Date: 7:17:42 on Mon 20 Nov 117.