EST 1609954 is a singleton


Sequence

>1609954 (1 EST) Length=262 GATTCATTCGCCCNGGTGCTGAANGAAGCGTAATGNAGCCAGACNATAACAATCAAGAGGACCGTGGAGGGTGGTGCGAG CACCCGAAGGGGAGACNACATGAACGGAGGTGGGCGGACGGCAGTATCGGAANAGTTGACGGAAGAGGGTATGTAAAATA AAGGGAGATAAAATGAGGTTGGCGGTGCTGCTGTGCGAAATGCGAGGGAANAAAAACAAGTGCTTTCTGACATGTTGGTG GGTGTGCCACGGCCATCAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609954: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099542992103AA882992TENS0569T. cruzi epimastigote normalized cDNA Library


Date: 3:59:0 on Sat 18 Nov 117.