EST 1609957 is a singleton


Sequence

>1609957 (1 EST) Length=268 CCNNGTTTCAAAAATCTTTGGTNTGTGGCGACATCAGGCGATGTGGCTTGCTTGACTGTCCATTGTGTACAATTTGCTTC AGGCGGTTATGCGGATTATTTTTGGTGGATTTCATCGACGGCCTGCGGCTTTGGACTCCGCTACTTCNNTTGCTTACCGT CAATCCGAGGCGGCAGTCGAGACNATGTTAGAGAAGCGACAGTTCTTTCGCACGCAATCACTTGCCACGCGCATACTGCG GACACAGAGCTTTGTGCAAAATGTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099572992106AA882995TENS0572T. cruzi epimastigote normalized cDNA Library


Date: 2:53:46 on Mon 20 Nov 117.