EST 1609966 is a singleton


Sequence

>1609966 (1 EST) Length=259 TTGCAAAAGGCGGAGAAGACCCNAGCCTCATNGTCCCGAAGCTCAAGGCCGAAATTGAGGGTCTCTCTTTCAAGGAAAGG GACTTGTCTCAGGCCGAAAACNAAATTGAAATGGAACGGCGCATCATTAAGGATCGGAGCGAGCAGTTGTTGCGCCGTAA TGAAAAGGCTCGCGTCNCGTCCGAAAAGGCGCGGCGGGAAATTGCGGATCTTGAAAAGAACTTGTCCGCTGTACGCGTCC GTTTTGAGTCCGCCGAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609966: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099662992115AA883004TENS0581T. cruzi epimastigote normalized cDNA Library


Date: 15:35:27 on Fri 24 Nov 117.