EST 1609973 is a singleton


Sequence

>1609973 (1 EST) Length=131 CACGAGCTTACTTACGCCTGTTATCCCTCGGGAAGAGCATAGACCGCCCACCAGCATTCTTCACCCAACTCTGTCCTGGG CAATATTTTTTCCAGTTCTTTCCAGTTGTTATTCATTCTTTTTCATTATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609973: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099732992122AA883011SMTBCEA000038SKSchistosoma Lambda Zap II cercariae


Date: 4:13:47 on Fri 24 Nov 117.