EST 1609978 is a singleton


Sequence

>1609978 (1 EST) Length=175 AGCACCGGAACCGTTGCTTATAAACCTGGAATCAATTTCATCAGAGGATTCAATCTTGTCAACACATATTCGAAACGATC AGAAATCCCTTAATTATGTATGGCAGAAGTGTCTAAAGTGAATGCATTAATGATCTAAGATCATTTATTATCCATAAATT TAATCTCACTTCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609978: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099782992127AA883016SMTBCEA000044SKSchistosoma Lambda Zap II cercariae


Date: 12:12:17 on Fri 17 Nov 117.