EST 1609979 is a singleton


Sequence

>1609979 (1 EST) Length=116 CTTGCTCCCATTGCTGGTTGAGGTAGGCGCACCAGGTGAAAGAGTGCATGTTCATCGGACGCCACTCTGCCACTAGCCAA TCGCCAGCATCCAGCGCATCGTACCAGGTTAACCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609979: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099792992128AA883017SMTBCEA000045SKSchistosoma Lambda Zap II cercariae


Date: 15:12:25 on Fri 24 Nov 117.