EST 1609982 is a singleton


Sequence

>1609982 (1 EST) Length=179 CTACACAGGCTGATTTATTCATCATACTCGCGACTTTCATCTTCGGAGCCAAGTCAACCTTCGAAAGTTGATAGTTCTGA TGAGTCCATCCCATTTAAACCGTACAGTCCTTTTCCAAAACCACAAGGGAAAATAGACTATGTATCACCCGGCTTGATGA TTTAGCAGACGGCCGAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609982: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099822992131AA883020SMTBCEA000049SKSchistosoma Lambda Zap II cercariae


Date: 6:9:50 on Wed 22 Nov 117.