EST 1609985 is a singleton


Sequence

>1609985 (1 EST) Length=186 GTTTAATTAGTATTTTCACCAGTGATCACTTTGTTGCATGTGTTTATGTTCGTTCAATTCTCTAGTTGGCCTTCGTTAGT GGGCCTTAAACATCAGTCTCCCTGGCCGACCATACGACGGTTACAGTTTCTTGTTATCTAGATAGTACCGTTGGCACGCA CATTGTTTTCTNGTAGTGTACACGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609985: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099852992134AA883023SMTBCEA000052SKSchistosoma Lambda Zap II cercariae


Date: 13:19:10 on Thu 23 Nov 117.