EST 1609989 is a singleton


Sequence

>1609989 (1 EST) Length=205 CTAAAAATACCCAAACTCCAATCTAATGTTCTAAAGTAAAAAGAAAAATGGGCAGATATACCTATCTATACTCTTTACCC TTCTTATTACAGCTAAAAATAATAGTTGAATTATGATATAATTTTGGAAAGATCTTTATTATTATTATTATTATTATTAT TATTATTATCAGTAGTAGTAGTAGTGAGTTGAATCGATTGTATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1609989: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099892992138AA883027SMTBCEA000056SKSchistosoma Lambda Zap II cercariae


Date: 12:31:55 on Sun 19 Nov 117.