EST 1609991 is a singleton


Sequence

>1609991 (1 EST) Length=179 TACCGCATCCTTTCATTGCCAGTTTTGGTGTTTATTATAACTTATCTTGACTAGTATTATAATCTTGTACGTTCACTTTG ATATTATTATTATTTTTCTTTATGCAATATGAATATATAACATTGGGAATACTTCTCTTGCTTAATTACTCTAGTATTTG TAATCTAAGTAACTACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609991: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099912992140AA883029SMTBCEA000060SKSchistosoma Lambda Zap II cercariae


Date: 6:17:23 on Fri 24 Nov 117.