EST 1609992 is a singleton


Sequence

>1609992 (1 EST) Length=275 TAGTTCATTTGTTATCTGATCTGCATAAAAGAGAATGTAAAAAAGACAATGGATCACATTTGAAATCGAATGATATTCTA GATGAAAAAGAATGTAATGATAAATTAGAAGACATGAAAGCTAAATCCAATGAAAGCACTTTAGAAAATTATTTATTTAA TACTGATATATCCAGTGTTTCATTCACTGATCTTTTGGAAGATGAAGCATTGCTAATTGTAGAATCTATTCTGTACATAG CAGGAGGTAGGCTGACAACAAGCATTGTGAAATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609992: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099922992141AA883030SMTBCEA000061SKSchistosoma Lambda Zap II cercariae


Date: 14:51:32 on Sun 19 Nov 117.